Filter Results
464 results
  • A description
    Data Types:
    • Other
    • Software/Code
    • Image
    • Video
    • Tabular Data
    • Dataset
    • Document
    • Text
    • Audio
  • RNAseq raw data of RNA extracted from five cervical cancer cell lines were mapped to HPV16 (NC_001526.2 or NC_001526.4), HPV18 (NC_001357.1), HPV68b (FR751039.1) and HPV45 (X74479.1). The processed BAM files were further analysed using The Hisat2 v2.1.0 aligner, Cufflinks v. 2.2.1, Cuffmerge and Cuffdiff. The processed sorted BAM files containing sequences of viral transcripts were shown as ‘sort BAM files’. The HPV16, 18, 45 and 68b transcripts data and their expression levels reported as FPKM can be visualized using IGV software. The number of total reads and viral reads after mapping to viral references were shown in ‘HR-HPV genes and isoforms FPKM tracking file’, the spliced transcripts were named as CUFF. The integration sites of four high risk HPV types were analysed and shown in ‘fusion file’. According to IGV visualization, the splicing junctions of all four HPV types were found within E6 and E1 regions. For E6 region, one splicing donor (SD) at the 5′ end and different splicing acceptor (SA) positions at the 3′ end were found as follow; three splicing junctions were found in HPV16 positive cervical cancer cell lines, CaSki and SiHa, SD226^SA409(E6*I), SD226^SA526(E6*II) and SD226^SA742(E6*X). Two splicing junctions were found in HPV18 (HeLa), SD233^SA416(E6*I), SD233^SA635, HPV45(MS751); SD230^SA412(E6*I), SD230^SA640 and HPV68b (ME180); SD129^SA311(E6*I), SD129^SA406. Splicing junctions within E1 region found in CaSki and SiHa were SD880^SA3358, SD880^SA3361, SD880^SA3391, SD880^SA1726, SD880^SA2405, SD880^SA2582(E1C), SD880^SA2709(E2*), SD880^SA3020, SD880^SA3078, SD880^SA3329, SD577^SA6810, SD898^SA1725, SD1302^SA2709, SD1302^SA3358(E2C), SD1760^SA3391, SD1263^SA3391, SD2309^SA3461 and the other forms were SD96^SA1063, SD226^SA2709 (E6*IV), SD226^SA3329, SD226^SA3358(E6*III), SD226^SA3361, SD226^SA3391 and SD579^SA6809. Splicing junctions within E1 region in HPV18(HeLa) were SD929^SA2779, SD977^SA1836, SD1342^SA1436, SD1987^SA2047 and one splicing event within E7 region, SD599^SA619. HPV68b(ME180) were SD839^SA2586, SD683^SA2586, SD839^SA2586 and no E1 splicing junctions were found in HPV45(MS751).
    Data Types:
    • Sequencing Data
    • Tabular Data
    • Dataset
  • Eleusine indica is a common weed that infests crops, turfs, and orchards. Chemical control of this weed is often based on glyphosate, an herbicide that inhibits the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). When the same herbicide is repeatedly used over years, target species might evolve resistance mechanisms that allow them to avoid the herbicide activity. A glyphosate-resistant biotype (19-1) of Eleusine indica has been recently found in Italy and ten plants that survived to glyphosate application (360 g ae ha-1) were collected to sequence the EPSPS gene and look for eventual point mutations. Primers EI_EPSP_F2 (5' TCTCAGGGAACAACTGTGGTG 3') and EI_EPSP_R2 (5' GGCAGTCAGTGCCAAGGAAA 3') were used to amplify a sequence of 460 bp, spanning the EPSPS codons 102 and 106. Point mutations at these positions are indeed widely known to endow glyphosate resistance in many species. The primer EI_EPSP_F2 was used for sequencing. All the 10 plants had the point mutation proline to alanine at position 106 (P106A, CCA to GCA) and therefore the main resistance mechanism was target-site mediated. This repository stores the Sanger Sequencing data of these 10 sequences plus 4 of susceptible plants (wild-type Eleusine indica EPSPS, biotype 19-S).
    Data Types:
    • Sequencing Data
    • Dataset
  • Fusarium oxysporum f. sp. cubense (Foc), a devastative soil-borne fungal pathogen causing vascular wilt (i.e. Panama disease) which leads to severe crop losses in most of the banana-growing regions of the world. The study aims to compare the proteome of the two pathogenic Foc virulent strains, Race 1 (Foc R1) and tropical race 4 (Foc TR4) that are capable of infecting the Cavendish group of bananas using 2-dimensional (2-D) gel electrophoresis, MALDI-TOF/MS and MS/MS analysis.
    Data Types:
    • Software/Code
    • Sequencing Data
    • Image
    • Dataset
    • Document
    • Text
    • File Set
  • ABSTRACT: Aviculturists are enthusiastic to be included in conservation efforts by providing expertise or genetic stock to support captive-breeding or reintroduction programs, but little work has explored these possibilities. Bringing organisms into captivity can have rapid and profound effects on behaviour, physiology and population genetic diversity, which can have important consequences for viability of reintroduction and the extrapolation captive experiments to wild counterparts. The Gouldian finch (Erythrura gouldiae) is a popular avicultural species that is endangered in the wild, and potential flagship for such reintroduction efforts. Here we used microsatellite and mitochondrial markers to characterise genetic diversity within and among avicultural populations in the broader population of domesticated Gouldian finches in Australia, and with respect to natural head-colour morphs and artificially selected plumage variation. Domesticated Gouldian finches have 32-48% lower genetic diversity compared to current wild populations, increased inbreeding, and genetic structure among aviculturists. Indeed, regardless of collection size no aviculturist approached the total diversity held among all breeders. Head-colour genotype frequencies were substantially different from the wild, and showed evidence of selection, or non-random mating. Given the previously established relationship between head-colour and functional traits, and possible adaptation to captivity, we suggest caution before introducing domesticated stock into the wild. Indeed, the status quo of relatively closed populations is potentially susceptible to inbreeding depression and further loss of genetic diversity, and we recommend a nationwide genetics-aware approach to any reintroduction programs.
    Data Types:
    • Software/Code
    • Sequencing Data
    • Tabular Data
    • Dataset
    • Text
  • Nucleosome turnover concomitant with incorporation of the replication-independent histone variant H3.3 is a hallmark of regulatory regions in the animal genome. Nucleosome turnover is known to be universally linked to DNA accessibility and histone acetylation. In mouse embryonic stem cells, H3.3 is also highly enriched at interstitial heterochromatin, most prominently at intracisternal A-particle endogenous retroviral elements. Interstitial heterochromatin is established over confined domains by the TRIM28-KAP1/SETDB1 corepressor complex and has stereotypical features of repressive chromatin, such as H3K9me3 and recruitment of all HP1 isoforms. Here, we demonstrate that fast histone turnover and H3.3 incorporation is compatible with these hallmarks of heterochromatin. Further, we find that Smarcad1 chromatin remodeler evicts nucleosomes generating accessible DNA. Free DNA is repackaged via DAXX-mediated nucleosome assembly with histone variant H3.3 in this dynamic heterochromatin state. Loss of H3.3 in mouse embryonic stem cells elicits a highly specific opening of interstitial heterochromatin with minimal effects on other silent or active regions of the genome.
    Data Types:
    • Other
    • Software/Code
    • Image
    • Sequencing Data
    • Tabular Data
    • Dataset
    • Document
    • File Set
  • Dataset for publication in data in brief
    Data Types:
    • Other
    • Software/Code
    • Slides
    • Sequencing Data
    • Image
    • Tabular Data
    • Dataset
    • Document
    • Text
  • Draft genome sequence data of E. rhusiopathiae strain VR-2 and annotation of the VR-2 raw data.
    Data Types:
    • Sequencing Data
    • Tabular Data
    • Dataset
  • The markdown file complies images and analyses related to the manuscript "Ultrasensitive DNA immune repertoire sequencing using unique molecular identifiers" (Johansson et. al., 2020).
    Data Types:
    • Software/Code
    • Sequencing Data
    • Tabular Data
    • Dataset
    • Text
    • File Set
  • Additional supplemental information (Fig. S4-25) for the manuscript: 'The New Red Algal Subphylum Proteorhodophytina Comprises the Largest and Most Divergent Plastid Genomes Known' by Muñoz-Gómez, S. A., Mejía-Franco, F. G., Durnin, K., Colp, M., Grisdale, C. J., Archibald, J. M., and Slamovits, C. H.
    Data Types:
    • Other
    • Sequencing Data
    • Dataset
    • Document