Visium data on human subcutaneous white adipose tissue (scWAT)
Description
The deposited data is presented in the manuscript by Bäckdahl J & Franzén L, et al., with the title "Spatial Mapping Reveals Human Adipocyte Subpopulations with Distinct Sensitivities to Insulin". Visium data in the format of Space Ranger output can be found for each individual section analysed (S41-S55), which contains raw and filtered count matrices and spatial/image data. Sample metadata contains information for each sample with linked subject information. Seurat objects containing the downstream analyses can be found as well, which for instance contains the spot clustering information presented in the article. Output data from the stereoscope analysis described in the article can be found here as well.
Files
Steps to reproduce
Space Ranger output found in folders named "S*_trimmed". To generate these files, raw FastQ files from the NovaSeq sequencing were initially processed with Cutadapt (Martin, 2011) to trim the R2 FastQ reads in order to remove 3’ polyA homopolymers and partial or full-length template switch oligo (TSO; AAGCAGTGGTATCAACGCAGAGTACATGGG) sequences starting at the 5’ end, thereafter the reads were processed with the Space Ranger pipeline (v. 1.0.0, 10x Genomics), where the reads were mapped to the GRCH38 v93 reference genome. Manual spot alignment was performed in the Loupe Browser (v. 4.0.0, 10x Genomics). Seurat objects (se_baseline.rds and se_insulin.rds) were generated from the Space Ranger output using the R packages STUtility (Bergenstråhle et al., 2020) and Seurat v. 3 (Butler et al., 2018a) in R (v. 3.6.3) . All R scripts used for the data analyses can be found at https://github.com/lfranzen/scwat-st.