FASTQ file of spontaneously fermented Ethiopian honey wine, Tej
Description
The aim of this research was to get an insight on the microbiota and microbiome involved in the spontaneously fermented Ethiopian honey wine, Tej. About 21 Tej samples were collected from three locations (Addis Ababa, Bahir Dar and Debre Markose) of Ethiopia. Due the natural fermentation system, our research hypothesis was, there will be a variation in the microbial community dominance among the samples collected from the same area and/or across the samples from different areas. However, the dominant bacterial or fungal genus were almost similar for both case of sampling situations. Nonetheless, these data were generated via high-through-put sequencing of the DNA that was extracted from the collected Tej samples. These FASTQ files are the raw data, that has to be pass through bioinformatics analysis using QIIAM 2, web-based calypso, and R studio to get a meaning full data. Meanwhile, after analyzing these raw data, the bacterial community structure was dominated by the genera of Lactobacillus (53.15%) and Zymomonas (38.41%). Similarly, the fungal community structure was exclusively dominated by genus of Saccharomyces (99.66%). Furthermore, both bacterial and fungal communities had shown no statistically significant differences in alpha diversity analysis based on the area of sample collection. However, the bacterial communities had a statically significant difference in Unweighted Unifrac beta diversity analysis. Nevertheless, still the bacterial quantitative beta diversity measurement had demonstrated that all of the samples had a similar dominate tax.
Files
Steps to reproduce
Sample collection, transportation and storage Twenty-one fully matured Tej samples were collected from Addis Ababa (lat. 8.9806, long. 38.7578), Bahir Dar (lat. 11.5742, long. 37.3614), and Debre Markos (lat. 10.3296, long. 37.7344), Ethiopia. DNA extraction About 40ml of Tej samples were centrifuged at 3200 rpm for 20 m to harvest the highest cell concentration. The microbial DNA was then extracted from the sediment via QIAamp PowerSoil Pro Kit (QIAGEN, Germany) by following manufacturer protocol. 16SrRNA sequencing Amplicon sequencing for each sample was performed using a barcode set of Nextera Library Preparation Kit (Illumina Inc., USA). The hypervariable (V4 -V5) region of 16S rRNA gene was PCR amplified by using 515F (GTGNCAGCMGCCGCGGTAA) as the forward-inner primer and 907R (CCGYCAATTYMTTTRAGTTT) as the reverse-inner primer [2]. The PCR amplifications by thermocycler (Mastercycler Nexus GSX1, Eppendorf, Germany) were performed in two phases. The first PCR was run at the condition of 95℃ for 5 min of pre-denaturation, followed by 15 cycles of 95℃ for 30 s of denaturation, 60℃ for 30 s of annealing, 72℃ for 30 s of extension, and 72℃ for 5 min of final extension [3]. The reaction mixtures were composed of 1 µL (1 µM) of reverse inner primer, 1 µL (1 µM) of forward inner primer, 2 µL DNA template, 25 µL Emerald Amp PCR Master Mix (Takara Co., Ltd., Japan). The total volume of the PCR reaction mixture was then adjusted to become 50 µL by sterilized distilled water (SDW). The second PCR was conducted under the same running conditions as the first, by adding bar code primers and 2 µL of first PCR amplified DNA templets. These PCR amplified products were then multiplexed to 100 ng/µL into the single product via measuring the DNA concentration. Finally, amplified and barcoded DNA having 550 bp of size were selected using AMPure XP for PCR Purification (BECKMAN COULTER Inc., USA) for further downstream procedures. Internal transcribed spacer (ITS) sequencing Fungal internal transcribed (ITS2) regions were targeted for amplification using the primers of ITS86F (GTGAATCATCGAATCTTTGAA) and ITS4 (TCCTCCGCTTATTGATATGC) [4,5]. The first PCR amplification was performed at a condition of 950C for 5 min, followed by 30 cycles of 950C for 30 s, 580C for 30 s, 720C for 30 s, and finally 72 for 5 min (Jung et al., 2020). The second amplification was also carried out in the same condition as it was done for the first one. The reaction mixtures for the above mentioned two PCR amplifications were composed of 1 µL (1 µM) of reverse primer, 1 µL (1 µM) of forward primer, 2 µL DNA template, 25 µL Emerald Amp PCR Master Mix, 21 µL sterilized distilled water (SDW). High-throughput sequencing Then amplicon libraries were directly subjected to the Illumina MiSeq platform by following the manufacturer’s instructions.