DRIP-qPCR validation
Description
1. HEK293 cells were obtained from the National Collection of Authenticated Cell Culture of China (accession number: SCSP-5014) and cultured in DMEM supplemented with 10% FBS and penicillin/streptomycin (100U/ml) at 37°C with 5%CO2. Expression vector carrying NOTCH2NLC exon1 with different numbers of GGC repeats were prepared and transfected into HEK293 cells as described before (36). 2. For DRIP-qPCR, HEK293 cells (5×106) were washed in cold PBS, treated with 1ml PBS and collected by centrifuge at 600g for 5min at 4°C. Cells were treated with PK buffer (100mM NaCl, 10mM Tris pH 8.0, 1mM EDTA, 0.5% SDS), 6ul Proteinase K (300ug/ml) and 3ul Ribolock RNase inhibitor, followed by incubation at 37°C for 5h. DNA was extracted by phenol-chloroform-isoamyl alcohol in light phase lock tubes, precipitated with 1.5 ul glycogen, 1/10 volume sodium acetate (40 ul) and 2.5-fold volume of ethanol (1000 ul) at -80°C for 30 min, spin at 14000 rpm at 4°C for 15min, washed twice with 70% ethanol and re-suspend in 50 ul Tris elution buffer (10 mM Tris-HCl pH 8.0). 3. DNA was digested by 3ul HindIII (20,000units/ml, NEB), 3ul BsrGI (20,000units/ml, NEB), 3ul XbaI (20,000units/ml, NEB) and 3ul SspI (20,000units/ml, NEB). For R-loop validation, fragmented DNA was pretreated with 3ul RNase H (0297S, 10-unit total NEB) at 37°C. Digested DNA was purified by 200 ul TE buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA pH 8.0), extracted by phenol-chloroform-isoamyl alcohol, followed by ethanol precipitation. 4. Immunoprecipitations were performed by diluting 4ug of fragment DNA to 150ul 1× binding buffer (10 mM NaPO4 pH 7, 140 mM NaCl, 0.05% Triton X-100, 1× PI and Ribolock) and 0.4ug withdrawn to serve as input in qPCR. RNA-DNA hybrids were immunoprecipitated with 3ug of S9.6 overnight at 4°C. 5. Magnetic beads were washed 3 times with ChIP-dilution Buffer, incubated with Blocking buffer at RT for 2 hours on the rotating platform and washed 3 times with BSA+PBS. After removing BSA+PBS, DNA/antibody complex was added to beads and incubated for 2-3 hours at 4°C. Beads was washed three times in binding buffer (+0.3 x PI, 2 ul Ribolock) and elution was performed in 150 ul elution buffer (10 mM Tris pH 8, 1 mM EDTA, 1% SDS and 6 ul Proteinase K) for 45 min at 55°C. After adding 150ul TE buffer, DNA was extracted by phenol-chloroform-isoamyl alcohol, followed by ethanol precipitation. Eluted DRIP DNA was washed twice with ethanol, re-suspended in 50 ul H2O and analyzed by qPCR. Primers used for DRIP-qPCR were CAATGATACCGCGAGACCCA (AmpR-F), CTTGATCGTTGGGAACCGGA (AmpR-R), AAGGACGACGGCAACTACAA (EGFP-F) and CGATGTTGTGGCGGATCTTG (EGFP-R).
Files
Institutions
- Wuhan University