Photoactivatible HDL and its transport in experimental psoriasis
Description
Lipoproteins trapped in arteries drive atherosclerosis. Extravascular LDL ligates LDL receptor for cellular uptake, whereas HDL interacts with cells to pick up cellular cholesterol, and then recirculates to plasma. We developed photoactivatable apoA-I to understand how HDL passage through tissue is regulated. We focused on skin and arteries of healthy mice versus those with psoriasis, which carries cardiovascular risk in man. Our findings suggest that immunity, programmed in lymph nodes draining inflamed skin, allows for IL-17-producing T cells to home to distal skin and later to arteries, where little pathology is observed except remodeling of collagenous matrix, such that larger molecules generally become entrapped. HDL transit was rescued by depleting CD4+ T cells, neutralizing IL-17, or inhibiting lysyl oxidase that crosslinks collagen. Experimental psoriasis was systemically associated with vascular stiffness and increased atherosclerosis, also driven by IL-17. Thus, IL-17 can reduce lipoprotein trafficking by, at least in part, remodeling collagen.
Files
Steps to reproduce
CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for reagents may be directed to, and will be fulfilled by, the corresponding author Gwendalyn J. Randolph (gjrandolph@wustl.edu). EXPERIMENTAL MODEL AND SUBJECT DETAILS Mice WT, apoA-I knock out, transgenic human apoA-I, TCRδ double knock out, RAG1 knock out, and CD11c-YFP transgenic mice (all C57BL/6 background) were purchased and obtained from the Jackson Laboratories (Bar Harbor, Maine, USA). Males, 8-10 weeks of age, were used in all experiments involving AAV vector infection due to preferential infection with AAV vectors in males versus females (Davidoff et al., 2003). Chy mice bearing a mutation in Flt4 gene, backcrossed onto the C57BL/6 background (Martel et al., 2013), were bred in-house. Heterogeneous PGA1 knock-in mouse (PGA1KI/+) was generated using the CRISPR/Cas9 approach, with the donor plasmid designed, assembled, and validated at the Genome Engineering and iPSC Center at Washington University School of Medicine (Department of Genetics). Single-cell, pronuclear injections were performed in the Micro-injection Core at Washington University School of Medicine (Department of Pathology). gRNAs and Cas9 mRNA were injected at a concentration of 2.5ng/l and 5ng/l, respectively. The donor plasmid containing the described insert flanked by 1000 bp homology arms (2000bp total) was injected at a concentration of 10 ng/l. The following primers were used to detect the success of PGA1 sequence insertion in 5’ junction: SM760.genomic.F 5’ AAACTGGCCACCGTACTCAG 3’; SM760.Junc.R 5’ CTTGCTCACCATTTGCTGCC 3’ (product size: 1383bp), and in 3’ junction: SM760.Junc.F 5’ CCAGCCATCTGTTGTTTGCC 3’; SM760.genomic.R 5’ GGAATTCGTCCAGGTAGGGC 3’ (product size: 1239bp). All experiments described herein were approved by the animal oversight committee at Washington University. METHOD DETAILS Experimental Psoriasis Model To induce experimental psoriasis, IMQ (Imiquimod Cream 5%, supplied with cream on sterile applicator pads, Perrigo. Co.) was applied daily to mice on the right ear or both ears, applying ~5 mg per ear daily for 7-21 days. To deplete mouse CD4+ T cells, or to neutralize IL17 or IL12/IL23p40 cytokines, 250 g of anti-mouse CD4 mAb (Bioxcell), anti-mouse IL17mAb (Bioxcell), anti-mouse IL12/IL23p40 (Bioxcell), or rat IgG2a isotype control (Bioxcell) was injected i.p. 2 days before IMQ treatment and injected every 4 days during the treatment period. To inhibit the lysyl amine oxidase enzyme activity, either vehicle (PBS) or 300mg/kg BAPN was injected i.p. every other day during the IMQ treatment period. Cloning of PGA1 cDNA-containing plasmids and PGA1 protein expression in cultured cells or in mice using AAV Structural models were rendered using MacPyMol v1.8.2.3 and Swiss-PdbViewer v4.1.0. Information for lipid-free apoA-I was from Pollard et al. (Pollard et al., 2016) for lipidated HDL disc from Bhat et al. (Bhat et al., 2007); and GFP 1EMA from the RCSB PDB pr