Paired Cq values of tcdB and 16S rDNA genes
Description
Paired Cq (cycle threshold) samples from tcdB positive samples (toxinogenic C difficile) reflecting total bacterial load and tcdB Cq value
Files
Steps to reproduce
Sample processing was equivalent to the one described in BD GeneOhm TM C diff Assay Manual (https://www.bd.com/resource). All oligonucleotides were synthesized by Integrated DNA Technologies (IDT) (Iowa, US): (5’TGCAGCCAAAGTTGTTGAAT3’) and (5’GCTCTTTGA TTGCTGCAC CT3’) tcdB tprimers, probe (/56-FAM/TCTGAAGGA/ZEN/TTACCTRTAATT GCAA/3IABkFQ/; QuantiNova Probe PCR kit (Cat No./ID: 208254, Qiagen, Canada); The full sequence of Inhibition Control Target was (5’TGCAGCCAAAGTTGTTGA ATGCAATGGTCCCAATGGCTAACGCGCAGAGCCTTCAGGTCAGAAATTTTTGCCATC CGAGACATCAGGTGCAGCAATCAAAGAGC3’), detected by hydrolysis probe /56-FAM/TTCTGACCT/ZEN/GAAGGCTCTGCGCG/3IABkFQ/. The relative normalization of sample was obtained using universal 16S rDNA amplicons, as a measure of total bacterial load, as described [23]. The qPCR was performed on Roche Light Cycler 480 instrument, following PCR program: hold at 94oC for 2 minutes and cycling of 45x (94oC, 10sec, following by priming, elongation and acquisition of fluorescence at 50oC for 20 seconds). The RFU (Relative Fluorescence Units) versus time/cycles curve was visually analyzed. Internal PCR positive control was genomic DNA ATCC 43255, adjusted to produce positive and reliable/stabile Cq value. LC480 software (V 1.5.1.62 SP3) was used to calculate Cq values using second derivate analyses and high sensitivity mode. Decisions of the result was made by operator (positive/negative/ inhibition), based on interplay between results of toxB and/or inhibition assays and curve shape, and/or generated Cq value. Total bacterial load quantifications were performed on additionally 10 times diluted sample (comparing to equivalent toxB sample) to assure that inhibition of 16S rDNA reaction is not a dominant factor in defining Cq value. The difference in Cq values among 16S and toxB reactions (each done in separate wells) was calculated and plotted, after correction for sample dilution.