F1000Research-125368, Zhou, Chen
Description
Raw data from RT-qPCR experiment, associated with Figure 4G. ARRIVE checklist – The ARRIVE Essential 10
Files
Steps to reproduce
1. Tissue RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega). 2. Complementary DNA (cDNA) was synthesized using the GoScript Reverse Transcription Mix (Promega). 3. cDNA was amplified and analyzed using iTaq universal SYBR Green Supermix (Bio-Rad) and the Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad). PCR protocol: DNA denaturation at 95°C for 3 min; denaturation at 95°C for 10 sec; annealing/extension and plate read at 60°C for 30 sec; 40 cycles of quantitative PCR. Results were normalized to u36B4. Period circadian protein homolog 2 (Per2)-forward (F), ATGCTCGCCATCCACAAGA; Per2-reverse (R), GCGGAATCGAATGGGAGAAT; Nuclear receptor subfamily 1 group D member 1 (Nr1d1)-F, TACATTGGCTCTAGTGGCTCC; Nr1d1-R, CAGTAGGTGATGGTGGGAAGTA; D site-binding protein (Dbp)-F, CGTGGAGGTGCTAATGACCTTT; Dbp-R, CATGGCCTGGAATGCTTGA; u36B4-F, AGATGCAGCAGATCCGCAT; u36B4-R, GTTCTTGCCCATCAGCACC. Experiments were repeated twice with similar results.