Giant cell tumor of ribs masking a huge soft tissue tumor: A potential diagnostic pitfall
Description
Primary giant cell tumor originating in the rib is rare, resembling giant cell tumor in the epiphyseal region of long tubular bones morphologically and immunologically. However, this lesion poses a great challenge for diagnosis due to uncommon clinical and radiological presentation and histological heterogeneity. Here we report two cases of huge giant cell tumor of ribs presented as soft tissue mass. The first patient presented as a large expanding soft tissue mass in the right thoracic cavity attached to the 4th and 5th ribs with bone destruction. The second patient showed an ill-defined soft tissue mass in the left retroperitoneum. The maximum diameter of the lesions are greater than 15cm. Apart from the typical lesion with giant cell tumor evenly distributed among the mononuclear cells, there are secondary change including multiple hemorrhage cyst formation, irregular ossification and spindle cell proliferation, which mimics malignancies. H3.3 p.G34W immunohistochemistry and H3F3A mutation detected by Sanger sequencing supported the diagnosis of giant cell tumor. Our studies emphasized radiological and histological polymorphism and the diagnostic value H3F3A mutation, with a review of other published reports to assess radiological and pathological diagnosis and outcomes in case of misdiagnosis and overtreatment.
Files
Steps to reproduce
Immunohistochemistry Rabbit monoclonal antibody H3.3 G34W (RM263, 1:2000) was purchased from RevMAb Bioscieces, and CD163(mab-0206,1:500), CD68(kit-0026,1:500) were purchased from Cell Signal Technology. 4-5 μm sections were prepared from formalin fixed and paraffin embedded waxes（FFPE）. Sections were baked overnight at 60℃ and subjected to citrate buffer (pH6.0)antigen retrieval after dewaxing and gradient dehydration, followed by hydrogen peroxide blocking, antibody incubation and staining using Elivision TMsuper HRP(Mouse/Rabbit) IHC kit (Kit9923, Maxin Biotechnologies) and DAB kit (ab64238, abcam, US.). Sanger sequencing DNA extraction: DNA extraction were prepared from 10 micro sections with tumor tissue >50%, using FFPE DNA kit (DP331, TIANGEN, Beijing), DNA quality and quantity were measured using ultraviolet spectrophotomete and stored at -20℃. H3F3A (c.103G>T) primer was designed as: sense: CATGGCTCGTACAAAGCAGA; anti-sense: CAAGAGAGACTTTGTCCCATTTTT; length: 170 bp. Conventional PCR protocol was performed in a thermocycler (Bio-Rad) under the following conditions: 95 °C 2min 95 °C 25 s 55 °C 30s ×30 72 °C 40s 72 °C 5min 4 °C ∞ PCR products were separated in 2% agarose gel and full-length H3F3A DNA were purified using the QIAquick PCR Purification Kit(QIAGEN, Beijing, China), then subjected to Sanger sequencing of H3F3A using the ABI 3730 High-Throughput DNA Sequencer (Applied Biosystems)