Metagenomics of a consortium from rhizosphere of Capsicum chinense plants
Description
The objective was to describe the composition of a consortium isolated from the rhizome of Capsicum chinense. To analyze the microbial consortium, samples from the rhizosphere of C. chinense plants with wilt symptoms. The consortium was maintained in V8 agar (Medina & Platt 1999). DNA extraction was done with ZymoBIOMICS DNA Microprep Kit (Zimo Research, https://www.zymoresearch.com/collections/zymobiomics-dna-kits). Analysis ITSs or 16S amplicons were sequenced (with replicate) MiSeq format 2x300, to obtain 300,000 PE readings by sample. Quality check of fastq files was performed with FastQC, then bioinformatics analyses were processed using readpipeline and MG_RAST (http://www.mg-rast.org/index.html)
Files
Steps to reproduce
ITS and 16S amplicons (PCR products) were sequenced; on both ends (Paired-end), in 2x300 format, on the Illumina MySeq system. Generating 2 fastq.gz files (Read 1 and Read 2), to later form 1 analysis file. ITS 1 5´TCCGTAGGTGAACCTGCGG 3´ 769-787 18s rRNA White et al, 1990 ITS 4 5´TCCTCCGCTTATTGATATGC 3´ 41-60 28s rRNA White et al, 1990 357 F 5´CTCCTACGGGAGGCAGCAG 3´ 339 V3 Turner et al. 1999 CD (R) 5´CTTGTGCGGGCCCCCGTCAATTC 3´ 939 V6 Rudi et al. 1997