JCVI-syn3A qPCR for origin/quarter/terminus ratios
Description
qPCR data presented in "Fundamental Cell Behavior Emerges from Whole Cell Simulations of a Minimal Cell by Integrating Experiment and Theory", Thornburg et al., 2021
Files
Steps to reproduce
The sequence for the Origin of replication qPCR 106 bp amplicon comprising Syn3A basepairs 354-459 is AATCGGTGCAAGTAATGAACAAGCTTTTATAGCAGTTCAAACAGTAAGTAAAAATCCTGGGATTTCTTATAATCCATTGTTTATTTATGGTGAATCTGGAATGGGA with reverse primer TCCCATTCCAGATTCACCATAAA. The sequence for the Quarter way around the genome 137 bp amplicon comprising basepairs 138,342-138,478 is GCTGACATAGGTGAAGGTCTAACAGAAGGAACAGTCGCTGAAGTTTTAGTTAAAGTTGGTGATGTTGTTAAAGAAGGACAATCATTATACTTTGTTGAAACTGATAAAGTAAACAGTGAAATACCTGCTCCAGTGGC with reverse primer GCCACTGGAGCAGGTATTT. The sequence of the Terminus of replication qPCR 39 bp amplicon comprising basepairs 271,774-271,783 is GCATTAGGCATTGTTGGCATAAATCCAGCACGAACGATGT with reverse primer ACATCGTTCGTGCTGGATTTA. The qPCR standard molecule is: AAAATTTTGTAATCGGTGCAAGTAATGAACAAGCTTTTATAGCAGTTCAAACAGTAAGTAAAAATCCTGGGATTTCTTATAATCCATTGTTTATTTATGGTGAATCTGGAATGGGAAAATTAGCATTAGGCATTGTTGGCATAAATCCAGCACGAACGATGTTATTTTGCTGACATAGGTGAAGGTCTAACAGAAGGAACAGTCGCTGAAGTTTTAGTTAAAGTTGGTGATGTTGTTAAAGAAGGACAATCATTATACTTTGTTGAAACTGATAAAGTAAACAGTGAAATACCTGCTCCAGTGGCTGGAAAAATTGCAG To prepare Syn3A cells for qPCR analysis, a 100 μl aliquot of cells grown in SP4 media (Williamson and Whitcomb, 1975) supplemented with 17% KnockOut Serum Replacement (hereafter called SP4KO) was mixed with 900 μl of fresh SP4KO. Multiple two fold dilutions of this cell suspension were then made by serially transferring 500 μl aliquots to tubes containing 500 μl of fresh SP4KO. A total of 15 dilutions were made and these tubes were capped and incubated at 37 ◦ C overnight. The stage of growth was determined by the color of the phenol red pH indicator. The highest dilution tube that was yellow was selected as the stationary phase culture. The most concentrated tube that had not begun transitioning from red to orange was designated exponential phase culture. To prepare the Syn3A genomic DNA for qPCR analysis, 10 μl of the exponential and stationary phase cultures were diluted 1:100 in water, incubated at 98◦ C for 10 minutes in a thermocycler with a heated lid and immediately added to the qPCRs. To prepare qPCR control DNA templates, a set of 6 two-fold dilutions was made using the gel purified DNA. The qPCRs were set up as follows: 5 μl PowerUp SYBR Green Master Mix (Applied Biosystems), 2 μl DNA template, 0.55 μl 10 μM forward primer, 0.55 μl 10 μM reverse primer, 1.9 μl H 2 O for a total reaction volume of 10 μl. Six replicates were made for each sample. Reactions were run in a QuantStudio 6 (Applied Biosystems) qPCR machine with the following program: Hotstart polymerase activation 50 ◦ C 120s, ramp 2.05 ◦ C/s, 95 ◦ C 120s; amplification 45 cycles of ramp 2.05 ◦ C/s, 95 ◦ C 15s, ramp -1.71 ◦ C/s, 52.9 ◦ C 15s, ramp 2.05 ◦ C/s, 72 ◦ C 60s; melting curve 95 ◦ C 15s, ramp -1.71 ◦ C/s, 52.9 ◦ C 60s, ramp 0.05 ◦ C/s up to 95 ◦ C. The Threshold Cycle (Ct) values were calculated automatically using the QuantStudio Software (Applied Biosystems) with the default parameters.
Institutions
- University of Illinois at Urbana-Champaign
- J Craig Venter Institute