Pectobacterium_carotovorum_21TX0081_16S_rRNA
Published: 30 August 2022| Version 1 | DOI: 10.17632/zw44bpc7d8.1
Contributors:
, , Description
Pectobacterium carotovorum was isolated from a diseased onion plant in Texas. The PCR product of 16S ribosomal RNA (rRNA) from P. carotovorum was Sanger sequenced. The raw forward and reverse orientation reads of 16S rRNA is reported here.
Files
Steps to reproduce
DNA extraction was done from the purified bacterial colonies using DNeasy Power Soil Kit (Qiagen, MD, USA). Polymerase Chain Reaction (PCR) was done using the universal primers 27F (5’- AGAGTTTGATCMTGGCTCAG -3’) and 1492R (5’- CGGTTACCTTGTTACGACTT -3’) to determine the sequence of the 16S rRNA gene. The PCR product was purified using ExoSAP-IT Express kit (Applied Biosystems, Waltham, MA) following manufacturer’s instructions, and Sanger sequenced (Eurofins Genomics, USA).
Institutions
Texas A&M University Central Texas
Categories
Bacterial Disease, Root Vegetable, Genome Sequencing