The role of Tpm1.6 in myofiboblast activation
Description
The critical role of Tpm1.6 in phenotypic change during myofibroblast activation. This dataset provides the raw information of the paper "Depletion of tropomyosin 1.6 alleviates TGF-β1-induced fibroblast activation by promoting the formation of an α-SMA-MMP9 matrix-degrading structure".
Files
Steps to reproduce
To reproduce this study, use NRK-49F rat renal fibroblasts or primary renal fibroblasts (passage ≤6), cultured on either soft collagen gels (1 mg/ml type I collagen, ~100 Pa) or collagen gel-coated dishes as a stiff control. Prepare collagen gels by mixing collagen with DMEM, NaHCO₃, HEPES, CaCl₂, and NaOH, and polymerize for at least 30 minutes. Induce myofibroblast activation by treating cells with recombinant TGF-β1 (10 ng/ml) for 24 hours. For Tpm1.6 silencing, transfect cells using liposome-mediated delivery of pcDNA6.2-GWEmGFP-miR vectors targeting exon 2b of Tpm1 (sequence: CAAATACTCCGAGGCTCTCAA), select with blasticidin, and enrich by FACS sorting for EmGFP fluorescence; use non-silencing miR as control. Assess myofibroblast activation via Western blotting and immunofluorescence for α-SMA, N-cadherin, and β1-integrin after TGF-β1 stimulation. Measure contractile force using PDMS-based micropost array detectors or AFM, and evaluate collagen degradation by gel contraction/degradation assay, Western blotting for collagen fragments, Cy3-CHP staining, and Cy3-gelatin degradation assay with or without MMP9 or pan-MMP inhibitors. Use immunofluorescence to detect canonical podosomes (cortactin/phalloidin) and non-canonical α-SMA dots, and assess colocalization with MMP9; visualize ultrastructural features by TEM with immunogold labeling for α-SMA. For in vivo studies, generate FoxD1GC-Acta2TpmKD mice by crossing Foxd1-GC Cre with Acta2TpmKD mice, induce renal fibrosis by unilateral ureteral obstruction (UUO) for 3–14 days, and assess fibrosis by Sirius Red/Masson’s trichrome staining, immunofluorescence for α-SMA, SGLT2, AQP1, LRP2, and plasma luciferase activity. Quantify protein and RNA levels using ImageJ and real-time PCR (normalized to β-actin), and perform statistical analyses with GraphPad Prism (Student’s t-test, one-way or two-way ANOVA). All key reagents, cell lines, mouse strains, and detailed protocols are listed in the manuscript’s STAR Methods and Key Resources Table, enabling full reproduction of the main findings.
Institutions
- National Cheng Kung University
- National Cheng Kung University Department of Physiology