Additional files of bacterial community for sainfoin silages addition with or without of Polyethylene glycol (PEG)
Description
Condensed tannins inhibit LAB fermentation via decreased Pediococcus relative abundance.Same procedure of ensiling as previous data showed. Data of bacterial community collected from before and after ensiling times(3, 7, 14,30,60 days of ensiling).
Files
Steps to reproduce
Total DNA of each samples was extracted with commercial DNA Kit (FastDNA® Spin Kit for Soil, MP Biomedicals, USA). The primers (338F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGGTWTCTAAT) targeting V3-V4 regions of 16S rDNA were used to conduct PCR amplification according to Ni et al., (2017,https://doi.org/ 10.1016/j.biortech.2017.04.055). Three replicates for each sample were conducted, and mixture of three replicates to sequenced. The amplicons extracted , purified and analyzed of raw sequences were followed the method describe by Su et al., (2019,https://doi.org/10.7717/peerj.7712)