Whole-Genome Sequencing Identifies Cryptic HOXD13 Variants in Syndactyly Pedigrees
Description
Genetic analysis was performed on three large syndactyly pedigrees with diverse clinical manifestations using whole-exome sequencing (WES) combined with whole-genome sequencing (WGS). WGS was conducted on probands following negative WES results. Identified pathogenic variants were validated by Sanger sequencing. Integrated WES and WGS analyses identified three novel HOXD13 variants: one 2-bp heterozygous deletion (c.314_315delAA, p.K105fs*131), and two heterozygous polyalanine expansions (PAE)—a 27-bp polyalanine duplication (c.186_212dupGGCGGCTGCGGCGGCGGCGGCGGCAGC, p.Ala63_Ala71dupAAAAAAAAA) and a 24-bp polyalanine insertion (c.203_204insAGCAGCGGCGGCTGCGGCGGCGGC, p.Ala64_Ala71dupAAAAAAAA). WGS successfully identified cryptic variants undetectable by WES technology.