HENMT1 expression in human cell lines

Published: 23 July 2026| Version 1 | DOI: 10.17632/phccbh57wx.1
Contributors:
,

Description

To compare HENMT1 protein expression in HeLa vs HEK293T cells ("HENMT1_HeLa_vs_HEK293T"), we harvested protein from the following: lane 1) HeLa (ATCC, #CCL-2); lane 2) HEK293T (ATCC #CRL-3216). To validate guides against HENMT1 in HeLa cells ("HENMT1_guide_validation"), HeLa-Cas9 target cells were infected with lentivirus carrying the following gRNAs: lane 1) hRosa; lane 2) CCACTAAATTTTTAACGAAC; lane 3) GTGGTGATACTTCACTCTTA; lane 4) GAGGATAAATTACGATGGAG; lane 5) ATTCGTTAGCTCCTTTCCTG; lane 6) ATGGTCAAATTCAGATCCCG; lane 7) ATTGTATCATGGCTCCGTTG; lane 8) GAGAGAGACTCTCGTTTGCT; lane 9) GAATCTCTTAAGGTCACTGA.

Files

Steps to reproduce

Cells were lysed in ice-cold RIPA buffer: 150 mM NaCl, 1% v/v NP-40, 0.1% w/v SDS, 0.5% w/v sodium deoxycholate, 50 mM TrisCl pH 8, 1x Complete mini protease inhibitor (Roche, #11836170001). DTT (50 mM) and bromophenol blue (0.013% w/v) were added to the lysates before heat denaturation. Proteins were separated by SDS-PAGE and transferred onto a 0.45 um nitrocellulose membrane (Biorad, #1620115). Transfer efficiency was checked by staining with Ponceau S (0.1% w/v) in acetic acid (5% v/v). Membranes were blocked in 5% w/v non-fat dry milk (Santa Cruz Biotechnology) in 1x TTBS (150 mM NaCl, 20 mM TrisCl pH 7.5, 0.05% v/v Tween-20). Human HENMT1 was detected using a primary antibody (Thermo Fisher, #PA5-55866, polyclonal rabbit, antigen sequence: MEENNLQCSS VVDGNFEEVP RETAIQFKPP LYRQRYQFVK NLVDQHEPKK VADLGCGDTS LLRLLKVNPC IELLVGV, corresponding to N terminal amino acids 1-77 of human HENMT1) diluted 1:250 in TTBS with milk overnight at 4C. Anti-rabbit HRP-coupled IgG was used as a secondary antibody (Jackson Immuno Research, #111-035-144). Images were developed using Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific, #32106) and the Odyssey Fc imaging system (Li-Cor). Membranes were stripped with Restore Western Blot Stripping Buffer (Thermo Fisher Scientific, #21059) and reprobed for GAPDH (Abcam, #ab8245).

Institutions

Categories

Western Blot

Funders

Licence