qPCR data on defence-related genes, SnRK1 and WRKY3, quantified in four tomato cultivars infected with Tomato curly stunt virus

Published: 27 June 2025| Version 1 | DOI: 10.17632/r4rk363x3c.1
Contributor:
Farhahna Allie

Description

This dataset contains qPCR data quantifying the expression of the defence-related genes SnRK1 and WRKY3 in four tomato cultivars (RooiKhaki, Moneymaker, NIL396 and ESTY) with varying resistance levels upon infection with Tomato curly stunt virus (ToCSV). The data includes cycle threshold (Ct) values for housekeeping gene Actin and the genes og interest, SnRK1 and WRKY3, measured in these 4 tomato cultivars at 8, 15 and 35 days post infection with ToCSV. This data provides insights into the transcriptional response of these key signalling genes during viral infection. The cultivars were selected based on their differing susceptibility to ToCSV, allowing for comparative analysis of defence mechanisms. Raw qPCR (.csv) files, and experimental metadata are included for reproducibility and further analysis.

Files

Steps to reproduce

RNA Extraction & Quality Check: Total RNA was extracted from susceptible, tolerant, and resistant tomato leaves (infected/mock-infected) using the Zymo RNA Miniprep Plus kit. Concentration/purity was measured via Nanodrop® ND-1000, and integrity was confirmed by 1% agarose gel electrophoresis with ethidium bromide. cDNA Synthesis: cDNA was synthesized from 250 ng/µL RNA using ProtoScript II kit (BioLabs). The 20 µL reaction included d(T)23 VN, random primers, and ProtoScript II enzyme mix, incubated at 65°C (5 min), 42°C (1 hr), and 80°C (5 min). cDNA was stored at -80°C. qPCR Setup: For qPCR, four infected (bioreplicate) and two mock (bioreplicate) samples were used per plant cultivar and time point. These samples were run in triplicate (analytical replicates), and a non-template control (2 µL nuclease-free water) was included. qPCR Analysis: SnRK1 and WRKY3 expression was quantified via qPCR (Bio-Rad CFX Connect™) using Luna SYBR Green. Each 10 µL reaction contained 1 µL cDNA (10ng/µL), 0.5 µL primers (SnRK1 or WRKY3 or Actin), and 5 µL master mix. Cycling: 95°C (2 min), 40 cycles of 95°C (5 sec)/55°C (30 sec), followed by melt curve analysis. Data were normalized to Actin and analyzed via the 2−ΔΔCt method. Primers: Actin: F: GGTATCCACGAGACTACCTACA; R: TGCTCATACGGTCAGCAATAC (Accession Number - Solyc11g005330.2) SnRK1: F: GCTCATTTGCCACGCTATTT; R: ATCCCATCTTAACCACCTCTTG (Accession Number - NM_001317176.1) WRKY3: F: TCCTCAGATTTGGTGGATGATG; R: ACCTAAAGTAGTGCCTTGGATAAG (Accession Number - HQ706095.1)

Institutions

Categories

Gene Expression, Plant-Pathogen Interaction, Real-Time Polymerase Chain Reaction, Plant Defense, Geminivirus

Funders

Licence