CYP450 Gene Cloning and Expression Patterns Induced by Two Neonicotinoid Insecticides in Megalurothrips usitatus
Description
Cytochrome P450、 (P450s) play a crucial role in insecticide detoxification and metabolic resistance in insects. In this study, we identified and characterized five P450 genes from the transcriptome of Megalurothrips usitatus, a major pest of leguminous crops. Full-length cDNA sequences were cloned and subjected to comprehensive bioinformatic analyses. The encoded proteins exhibited typical hydrophobic properties, with secondary structures dominated by α-helices and random coils. Notably, phosphorylation site prediction revealed a high frequency of serine residues. Phylogenetic analysis demonstrated close evolutionary relationships between these P450s and their orthologs in Frankliniella occidentalis and Thrips palmi. Bioassays revealed that field-collected M. usitatus populations from Haikou had developed moderate resistance to both dinotefuran (LC50 = 849.199 mg/L) and sulfoxaflor (LC50 = 165.991 mg/L). Quantitative real-time PCR analysis showed that CYP6EB24 expression was dramatically upregulated by 8.9-fold (P < 0.0001) and 9.6-fold (P < 0.0001) following exposure to LC25 concentrations of dinotefuran and sulfoxaflor, respectively. Spatiotemporal expression profiling indicated highest CYP6EB24 transcript levels in female adults and thoracic tissues. Correspondingly, cytochrome P450 enzyme activity increased significantly (P < 0.05) after insecticide treatment at LC50 concentrations. These results provide compelling evidence that CYP6EB24 plays a pivotal role in the metabolic detoxification of dinotefuran and sulfoxaflor in M. usitatus. Our findings not only advance the understanding of P450-mediated resistance mechanisms in M. usitatus but also establish a foundation for future functional studies of detoxification genes in this economically important pest species.
Files
Steps to reproduce
1. Biological determination and treatment of M. usitatus For the control group, employ the solvent without any additives. Introduce a cohort of 25-30 female adult M. usitatus into each prepared tube, followed by the addition of cowpea segments treated with the corresponding pesticide concentration. Secure the tubes with gauze covers and seal them to prevent the escape of the M. usitatus. Maintain uniform rearing conditions throughout the experiment. After a period of 48 h, assess the mortality rate of the female M. usitatus, with the criterion for death being the lack of response to a brush stimulus. Employ Poloplus (LeOra, USA) to calculate the slope of the toxicity regression equation, the sublethal concentration (LC25), and the half-lethal concentration (LC50) for the female M. usitatus, all with a 95% confidence interval. Validate these findings against a chi-square table to confirm their conformity with the probability model. Based on the results of the bioassay, select flonicamid and dinotefuran at LC25 and LC50 concentrations for the treatment of the M. usitatus, using the identical methodology as previously outlined. 2 Establishment of the RT-qPCR standard curve and analysis of the expression patterns of P450s In this study, total RNA was extracted from the samples via the Trizol method, and the M. usitatus cDNA template was diluted into five concentration gradients: 1/4, 1/16, 1/64, 1/256, and 1/1024 of the original concentration, in accordance with the kit’s protocol. Subsequently, RT-qPCR amplification was conducted on the diluted samples using the Quant StudioTM5 real-time fluorescent quantitative PCR instrument (Thermo Fisher Scientific, USA), in line with the operational instructions of the TB Green Premix EX TaqTM (TⅡ RNaseH Plus) (RR420A, TaKaRa, Japan) fluorescent quantitative kit. Each concentration gradient was subjected to three mechanical repetitions, and a standard curve was constructed using a linear regression model. The efficiency (E) of the primers used in RT-qPCR was determined using the formula E =(10[−1/slope]−1)× 100. Following the creation of the standard curve, RT-qPCR was performed on the processed M. usitatus samples using the aforementioned method. M. usitatus ACT served as the internal reference gene, with the primer sequences being Forward primer Sequence (5’->3’): ACGACGTACAACTCCATCAT; Reverse primer Sequence (5’->3’): GTAATCTCCTTCTGCATCCTGT. 3 Determination of P450s Enzyme Activity of M. usitatus In adherence to the operational guidelines of the insect cytochrome P450 enzyme-linked immunosorbent assay kit(FY90006-A).
Institutions
- Hainan University