Transcriptomics reveals the foraging gene regulating the division of labor in Apis mellifera
Description
Prominent traits of social insects, such as defense and foraging, are the outcomes of collective effort by many individuals. The processes that integrate worker behavior into coordinated colony patterns are not well understood. In this study, two types of division of labor (DOL) in Western honeybees (Apis mellifera) were examined: foraging (nectar, pollen, and water collection) and defense (guard bees). Methods including the proboscis extension response (PER), quantitative polymerase chain reaction (qPCR), enzyme-linked immunosorbent assay (ELISA), and transcriptome analysis were employed to investigate internal regulatory mechanisms underlying these behaviors. The results showed that PER and gustatory response score (GRS) values for tasks such as water collection were significantly higher than those for defense tasks, while no difference was observed in nutritional foraging tasks like nectar and pollen collection. The relative expression levels of Amfor and PKG activity in water foragers were significantly higher than in guard bees, and pollen foragers showed higher levels than nectar foragers in nutrient collection tasks. Transcriptome analysis revealed that, compared with nectar foragers, the Amfor gene was significantly downregulated in defense and upregulated in pollen and water foragers. Compared with pollen foragers, 43 differentially expressed genes (DEGs) were identified in nectar foragers and 94 DEGs in water foragers. In contrast, 418 DEGs were found when compared with guard bees. DEGs in water foragers were related to body surface morphology, waterproof wax synthesis, and ion and water transport in the Malpighian tubules. In nectar and pollen foragers, DEGs are mainly involved in cGMP synthesis and actin binding. DEGs in defense tasks included genes related to retinol metabolism, olfaction, neurotransmitter transport, and responses to environmental changes. KEGG enrichment analysis showed that pathways regulating movement, cGMP-PKG signaling, oxidative phosphorylation, and thermogenesis, were uniquely enriched in foraging and defense tasks. Weighted Gene Co-expression Network Analysis identified that Nos (nitric oxide synthase), Camkii (calcium/calmodulin-dependent protein kinase II), and genes encoding cGMP-dependent protein kinase (PKG) were part of the cGMP-PKG pathway. These findings indicate that the foraging gene acts as a regulatory factor in the DOL in Western honeybees. Although the specific neuroethological functions of the foraging gene in the insect brain remain unclear, the PKG signaling pathway plays a storage role in neuroplasticity related to sensory, cognitive, and motor functions, forming the basis for behaviors such as foraging and aggression.
Files
Steps to reproduce
1. Bee capture We captured the bees by using a tube, either at the hive entrance, at the edge of the water tank, or at the feeder. For the PER test, the captured bees were transported to the laboratory and immediately placed in a −20°C freezer for 3 min and 30 s to immobilize them. For the qPCR test, the bees were collected in a frozen storage tube, immediately placed in liquid nitrogen, and then stored at −80°C. 2. Bee fixation and PER test Following the method described by Scheiner et al.,[19]we rapidly fixed the immobilized bees onto a tube by using tape, allowing their heads to move freely. Bees were then placed in an incubator at 25°C with 75% humidity for 10 min to eliminate any dead or weak bees. We then stimulated the honeybee antennae for 3 s with sugar solutions at the following concentrations: 0, 0.1, 0.3, 1, 3, 10 and 30 (%, v/v). To prevent sucrose inertia effects, we maintained a 2-min interval between stimulations with each concentration. This process was repeated three times for each group of 24 bees. 3. Association between Amfor expressionand DOL in honeybees Honeybees were removed from the −80 °C freezer and transferred to the experimental workbench using liquid nitrogen. After removing the heads of 12 honeybees, they were ground in a mortar with liquid nitrogen. Total RNA was extracted according to the Trizol manual and dissolved in 40 μL of nuclease-free water. Total RNA degradation was detected by 1% agarose gel electrophoresis. Nucleic acid concentration was measured using NanoDrop™ (NanoDrop). The nucleic acid was diluted with nuclease-free water to 1 μg/μL in a volume of 10 μL. cDNA was synthesized following the kit instructions. The kit was used to determine whether the relative expression level of the target gene Amfor was related to DOL by the SYBR method. The primers for the Amfor gene were: Amfor-F: TTGCCTGGTGATAGACCGTG and Amfor-R: TCGCTCTATTCTCCCATCCTTC. There were three technical replicates for each group, and each gene was replicated at least three times. 4. Determination of PKG enzyme activity in honeybee heads We randomly selected 10 honeybee heads from each task group, added an appropriate amount of normal saline for homogenization, and then centrifuged at 3000 g for 10 min at 4 °C to collect the supernatant. The Insect cGMP-Dependent Protein Kinase (PKG) ELISA Detection Kit (Jingmei Biotechnology Co., Ltd., Jiangsu, China) was used to measure PKG enzyme activity in honeybee heads according to the instruction manual. Each task group was tested three times.
Institutions
- Yunnan Academy of Agricultural Sciences